                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:107 nt.    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-11.60 kcal/mol
Antiterminator:    Distance from promoter:82 nt. Size=34 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGACC-TCTAAT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGACCTTTTAGAAAAATATCATCTAATGATTCCAGTTGTAGAAATAGACGAAAAACA
AGTAGAATATGGTAACATTCACAAAGGTGTCATAATAAACTATATAAAGAATGCAGTT
AAGAGTTGAataagtttctatctcctgttacaataatacacgtagcagggattatttttttaacctatgtgggacgcaaaatgtcactacggga
cgtaaagtgaccacagaggaaaaatgaaccaatgtagtgaggagaaaagatATG

    BA_0228 --- BA_0227 Gene: BA_0228     GI: 21397603     BI number: BA_0228     GOG: COG2390     Description: hypothetical protein predicted by GeneMark Gene: BA_0227     GI: 21397602     BI number: BA_0227     GOG: COG0057     Description: gpdh_C, Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domai   a a  g t  t at        at At       a  a Gc       t  c |  t      a  a T  a      a  c T  t       cg Gc        at At        ta Gc        tg A  |       gc A  |       ta T  |       cg T  |       cg Gc       t  | At        cg Cg        ta Gt        at             tatttttttaacctatgtgggacgcaaaatgtcactacgggacgtaaagtgaccacagaggaaaaatgaaccaatgtagtgaggagaaaagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2390 Transcriptional regulator, contains sigma factor-related N-terminal domain ... can be seen here [G] COG0057 Glyceraldehyde-3-phosphate dehydrogenase/erythrose-4-phosphate dehydrogenase ... can be seen here     ..................................................................................................................