Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:185 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.60 kcal/mol

                                                                        Nomenclature/Definitions

TTTTCAATTATAAGTTCAATTATTACCTTTATTTTAGGATTTGCGATTGTTACTTATT
TCGGTAAGAAATAAcggctttaatccccttggcgataaaaatcgttaaggggatttttcatgctatacattgaaagtccaggcatttaca
ttgcttgttatagaaagcttttttaaaattgttgagtagcatatgcttagggaaagaggactggctccttcgttgtagcaaactgtttttgatagtataa
tgaaatgagtatgcagtgagaaatttgctgcaagtagctgaggtgaagaaacATG

    BA_0243 --- BA_0242 --- BA_0241


Gene: BA_0243     GI: 21397618     BI number: BA_0243     GOG: COG0494     Description: NUDIX, MutT-like domain
Gene: BA_0242     GI: 21397617     BI number: BA_0242     GOG: COG1660     Description: hypothetical protein predicted by GeneMark
Gene: BA_0241     GI: 21397616     BI number: BA_0241     GOG: COG0391     Description: UPF0052, Uncharacterised protein family UPF005


          aa
         a  a
          ta
          at
          gc
          cg
          gt
          gt
          ta
          ta
          cg
          cg
          cg
          cg
          ta
            tttttcatgctatacattgaaagtccaggcatttacattgcttgttatagaaagcttttttaaaattgttgagtagcatatgcttagggaaagaggactggctccttcgttgtagcaaactgtttttgatagtataatgaaatgagtatgcagtgagaaatttgctgcaagtagctgaggtgaagaaacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here
[R] COG1660 Predicted P-loop-containing kinase ... can be seen here
[S] COG0391 Uncharacterized conserved protein ... can be seen here

    ..................................................................................................................