                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:163 nt.    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-12.70 kcal/mol
Antiterminator:    Distance from promoter:120 nt. Size=56 nt.     Delta G= -3.39 kcal/mol
Anti-antiterminator:    Distance from promoter:90 nt.    Size=37 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCACA-AATAGG. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCACATATTTAATTTGGTATTCAATAGGACGCTTTTTCGTAGAAGGGTTACGTACAG
ATAGTTTAATGCTAGGACCGCTTCGTATTGCACAAGTAATGTCAATTGGACTTGTTGT
TATTTCTATTATTTTCATTATTGTGAGACGAAAAATGGGGCAAGCTGATAAAAGATAT
TCGGAAAATTAGagacaagtagcatcttattataagatgctgcttctttcatattcaggaaagagaaaggactaaggcaATG

    BA_0248 --- BA_0247 Gene: BA_0248     GI: 21397623     BI number: BA_0248     GOG: COG0546     Description: Hydrolase, haloacid dehalogenase-like hydrolase Gene: BA_0247     GI: 21397622     BI number: BA_0247     GOG: -------     Description: hypothetical protein predicted by GeneMar            GA           G  A           C  A           T  A           T  T            AT            TA           A  G           G  a AT       A  g T  T      A  a TG       A  c AT       A  a CG       T  a TA       A  g TG        Gt TA        Ta         t |  C       Cg       t  a |  G       Gc        at |  A      A  a       ta T  A      A  |       ta A  A      C  |       cg TA        Gt        ta TA        Gc        at AT        Gt        cg TG        Gt        gc CG        Ta        at TG        At        tg TG        At        gc                         ttctttcatattcaggaaagagaaaggactaaggcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0546 Predicted phosphatases ... can be seen here     ..................................................................................................................