                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:101 nt.    Distance to gene:53 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G=-16.80 kcal/mol
Antiterminator:    Distance from promoter:69 nt. Size=42 nt.     Delta G= -5.14 kcal/mol
Anti-antiterminator:    Distance from promoter:36 nt.    Size=56 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtga-tattat. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtgattggtactgtaggtttatcgtattatttattactattagctcattatcataaaacagcaacgagcgttgttgttggagcacttattttattttg
tgggcgtgctgtacacaaggggttatttccataaaagctgtttatacaaagagtataaacagctttttgtatttttttacaaaaggctcgaaagttacgt
aacgtcatcttttataatgaaggggaagaggtgATG

    BA_0258 --- BA_0257 Gene: BA_0258     GI: 21397633     BI number: BA_0258     GOG: COG0789     Description: HTH_MERR, helix_turn_helix, mercury resistance Gene: BA_0257     GI: 21397632     BI number: BA_0257     GOG: NOG27104     Description: hypothetical protein predicted by GeneMar at t  t t  t t  t tg at tg         a tg       t  t |  g      t  t |  c       gt cg        gc at        gc cg       g  a gc       a  t        a at       a  a      a  g g  g      c  a      a  a gt       a  a       cg ta       c  |       at |  c      a  |       ta ta       t  |       at gc       g  |       ta ta        ta        ta ta        cg        ta g  g       gc        gc tg       t  |       ta tg        gt        cg g  |       cg        gc cg        gt        at gt        gt        at at        gt        at                         ttgtatttttttacaaaaggctcgaaagttacgtaacgtcatcttttataatgaaggggaagaggtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0789 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:103 nt.    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.00 kcal/mol Antiterminator:    Distance from promoter:69 nt. Size=42 nt.     Delta G= -5.14 kcal/mol Anti-antiterminator:    Distance from promoter:34 nt.    Size=56 nt.     Delta G=-10.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgtga-tattat. It has a score value of 65.6 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgtgattggtactgtaggtttatcgtattatttattactattagctcattatcataaaacagcaacgagcgttgttgttggagcacttattttattttg tgggcgtgctgtacacaaggggttatttccataaaagctgtttatacaaagagtataaacagctttttgtatttttttacaaaaggctcgaaagttacgt aacgtcatcttttataatgaaggggaagaggtgATG     BA_0258 --- BA_0257 Gene: BA_0258     GI: 21397633     BI number: BA_0258     GOG: COG0789     Description: HTH_MERR, helix_turn_helix, mercury resistance Gene: BA_0257     GI: 21397632     BI number: BA_0257     GOG: NOG27104     Description: hypothetical protein predicted by GeneMar tt t  a t  t a  t tt tt cg         a at       t  t |  g      t  t |  g       gt cg        gc gc        gc ag       g  a gt       a  t gg       a  a t  c      c  a        a tt       a  a      a  g gg       c  |      a  a |  t      a  |       cg ta       t  |       at tc       g  |       ta ga        ta        at tc        cg        ta t  a       gc        ta ga       t  |       ta cg        gt        gc g  |       cg        ta ag        gt        cg gg        gt        gc cg        gt        at                         ttttgtatttttttacaaaaggctcgaaagttacgtaacgtcatcttttataatgaaggggaagaggtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0789 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................