                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:203 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.20 kcal/mol
Antiterminator:    Distance from promoter:183 nt. Size=31 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:    Distance from promoter:147 nt.    Size=40 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tacaat. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaaactcgtttgtatgcgcatacaataaaggtaatattatgaaaggaaggtactttgaccaatgaatttctaattctcttatttatttcatccatc
acaaatagtgaacaaaaatgatgaaaactagcaggggattagtctgtccatttgtcgatactttctttcgaaacgatcatgtaaaaaaatcgtttattta
tgtacgatttttacatgcaagggcgacgtttatcctctctagtgaaactagggaggtttttttATG

    BA_0266 Gene: BA_0266     GI: 21397641     BI number: BA_0266     GOG: COG0488     Description: ABC_tran, ABC transporte tt t  a a  t t  g t  t ta        tt gc       g  t cg       c  a ta        at at        gc         a a  |      c  |      g  a a  |       gc       t  a at        gt        gc at        gc        at at        at        ta at       a  c       cg ta       c  t       tg gc       g  a       cg ta        tg        ta at        at        cg cg        cg        cg                         tttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................