                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-21.70 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTTACTACCCGGAGAAATGATTACGAAAGTAAATGGAGTCATTCCAAGAAGCGCTGA
GGAATTTTATGATGCGCTTCAAACGAAGACGACAGGAGCATTTTGTAAATTAGAAGTA
TTAGATACAAATGGTGAGCTTCGCCTTGCTCAAACGGCATTATACGCCGGAGGACATC
ATGAACTAGGTATTGTATTTGTTCAGCAGGAGCATGAGTGGGATTCGGAAGCGATGTA
AtagaagtgagggtgtcaccttgaggtgacgcccttttttgttgggggcggaggaaggtagttagtaaATG

    BA_0269 Gene: BA_0269     GI: 21397644     BI number: BA_0269     GOG: -------     Description: hypothetical protein predicted by GeneMar   C T  A T  G GC TA TG TG A  A TG GC TA T  T A  G       AA T  A      T  t G  G      G  a G  T      T  g A  G      A  a TG       G  a CG        Cg |  A       Gt        tg AT       A  g      t  a AT       A  a       cg GC       G  |       cg TG       G  |       at |  G       Cg        cg |  A       Tg        ta |  A       Tg        gc |  G       At        tg A  C      G  g       gc CG        Gt        gc TA        Gc        gc AT        Ta        at CG        Gc        gt                         ttttgttgggggcggaggaaggtagttagtaaATG     ..................................................................................................................