                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:43 nt.    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-17.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-AATGAT. It has a score value of 63.59 and is shown in blue

TTGAAAAAATCCGTTCTGGAGAAAATGATCTCCAATTACAGTCAGCATTAAAATTAAT
GGCGAAATAAaaagaaatacaggcagtttgctgcctgtatttttttgtgttaaacaaacgcttgtccagttatgataatataaaaagaaagaa
tgatataaATG

    BA_0270 Gene: BA_0270     GI: 21397645     BI number: BA_0270     GOG: COG0265     Description: hypothetical protein predicted by GeneMar           tt          t  g           gc           at           cg           gc           gc           at           cg           at           ta           at           at           at             ttttgtgttaaacaaacgcttgtccagttatgataatataaaaagaaagaatgatataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0265 Trypsin-like serine proteases, typically periplasmic, contain C-terminal PDZ domain ... can be seen here     ..................................................................................................................