Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:79 nt.    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -8.90 kcal/mol
Antiterminator:    Distance from promoter:42 nt. Size=74 nt.     Delta G= -8.46 kcal/mol
Anti-antiterminator:    Distance from promoter:23 nt.    Size=53 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCCA-TACAGT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCCACAAGTAATTGATTACTTACAGTCACAAGGATACAAACTTCTTCCCTATAATC
CATCTTCTCATCTCAAAGTAAACTTTTGGAAAGACACAAGATTGTAAcagctttagtacctatat
actaaagctgttttatttttctcttcccacccttcctatttttgtgtaaaattttaaatagtgatgaagtttcgaggtgaatagaaATG

    BA_0290


Gene: BA_0290     GI: 21397665     BI number: BA_0290     GOG: COG3933     Description: Sigma54_activat, Sigma-54 interaction domai


           ag
          c  c
           At
           At
           Tt
           Ga
          T  g
           Tt
           Aa
           Gc
          A  c
 AA       A  |
T  A       Ct
 GC        Aa
 AT        C
 AT       A
 AT       G
C  T      A
 TG       A
 CG       A
 TA        G
A  A       G
C  |       T
 TA        T
 CG        T
 TA        T
T  C       C        ta
C  A      |        c  t
T  C      A        c  a
A  A      A         at
C  A      A         ta
 CG       T         gc
 TA       G         at
 AT       A         ta
 AT       A         ta
 TG        A        ta
 AT        C        cg
 TA        T        gc
                        tgttttatttttctcttcccacccttcctatttttgtgtaaaattttaaatagtgatgaagtttcgaggtgaatagaaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG3933 Transcriptional antiterminator ... can be seen here

    ..................................................................................................................