                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:87 nt.    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-13.30 kcal/mol
Antiterminator:    Distance from promoter:59 nt. Size=36 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:26 nt.    Size=45 nt.     Delta G= -7.44 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCTA-TACCAT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCTATGACAATTAATCCACTTGTACCATCAGATAAAGTTGCAAAACAAATTTTAGA
TGAAATGTTGGAAGCGCATAAAGAATATCTTCCGCAGTTCTTCAAAAAGGTAGAGAAA
TAAaagcggcgctatttagcccgctttttttattctattaggaggtattacgATG

    BA_0293 Gene: BA_0293     GI: 21397668     BI number: BA_0293     GOG: COG3394     Description: hypothetical protein predicted by GeneMar AA A  G T  A A  A       AA C  T      A  G G  A      A  G C  T      A  T GC       C  A AT        TG AT        TA        tt GC        CG       a  t GC        TA        ta T  |       TA        cg TG       |  A       gc GC       |  T      c  | TA       |  A       gc A  G      |  A       gc AT       G  a       cg AT       A  a       gc GC        Cg        at T  T       Gc        at AT        Cg        At GC        Cg        At                         tttattctattaggaggtattacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3394 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................