                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:154 nt.    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-22.50 kcal/mol
Antiterminator:    Distance from promoter:130 nt. Size=29 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttttca-tatgat. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttttcatttttcagattatcgtgtatgatgagaaagtattgaaaattaaatcagtgataaactaggggtgcctaacgtatgcgtaggctgagagagaagc
gcgtaaacttcttaaccctttggacctgatctggctcgtaccagcgtagggaagttaacggctttacataatgatgtctttatgagccaggtccttattt
ttttatggacctggctctttttattttggcatacgctggccatatctcgtccttgtcacgtacaggggggcaacaaaggttATG

    BA_0314 Gene: BA_0314     GI: 21397689     BI number: BA_0314     GOG: COG0422     Description: ThiC, ThiC famil            tt tg       t  t a  t      t  t g  c       at t  t       ta at       t  t at        cg ta        cg at        ta cg        gc a  |       gc t  |       at t  |       cg ta        cg cg        gc gc        at gc        gc             tttttattttggcatacgctggccatatctcgtccttgtcacgtacaggggggcaacaaaggttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0422 Thiamine biosynthesis protein ThiC ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................