                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:58 nt.    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -7.30 kcal/mol
Antiterminator:    Distance from promoter:22 nt. Size=49 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtaa-taaaat. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtaagattttttcgttaaataataaaattttcaaaaaaatctttttaaatagaaattgttatggtacagtataaatgaaagttattgaaaacgttttc
ttaaacgtttttttatttttaggctgaaaggtatgatgacctgatagtctattgatgaggttattctatttaaaaggggattctttagggggagagaaca
ATG

    BA_0315 Gene: BA_0315     GI: 21397690     BI number: BA_0315     GOG: COG1620     Description: Lactate_perm, L-lactate permeas   g t  a a  a a  a a  g t  t at ta gt at cg a  a t  a g  | g  | t  |       ct a  |      t  t ta        ta ta        ta gc        ta tg        gc t  t       cg at        at at        at at        at gc        at at        gt             ttatttttaggctgaaaggtatgatgacctgatagtctattgatgaggttattctatttaaaaggggattctttagggggagagaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1620 L-lactate permease ... can be seen here     ..................................................................................................................