                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-21.30 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGGTCATGACTTAACAGCGAACCCAAACATGAAAATGATTGCTGTTGATCCGAAAGT
AATCCCATTAGGATCTAAAGTATGGGTAGAAGGTTACGGAGAAGCGATCGCTGGAGAT
ACTGGCGGTGCAATTAAAGGTAACCGTATCGACATCCTACTTGGATCAGATAGCGCTG
CTCAAAAATGGGGACGCAAAACTGTTAAAGTGAAAATTTTAAAATAAccaatgactgctgaagcc
agttctctttgttgagagctggcttttatttttttataatagctataagggggctatactcATG

    BA_0329 Gene: BA_0329     GI: 21397704     BI number: BA_0329     GOG: -------     Description: hypothetical protein predicted by GeneMar            tg           t  t ag       t  t a  c       cg gc        ta ta        cg cg        ta gt        tg t  t       gc c  c       at at        cg gc        cg t  t       gc at        at at        at cg        gt             tatttttttataatagctataagggggctatactcATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-19.10 kcal/mol Antiterminator: Size=28 nt.     Delta G= -5.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGGGTCATGACTTAACAGCGAACCCAAACATGAAAATGATTGCTGTTGATCCGAAAGT AATCCCATTAGGATCTAAAGTATGGGTAGAAGGTTACGGAGAAGCGATCGCTGGAGAT ACTGGCGGTGCAATTAAAGGTAACCGTATCGACATCCTACTTGGATCAGATAGCGCTG CTCAAAAATGGGGACGCAAAACTGTTAAAGTGAAAATTTTAAAATAAccaatgactgctgaagcc agttctctttgttgagagctggcttttatttttttataatagctataagggggctatactcATG     BA_0329 Gene: BA_0329     GI: 21397704     BI number: BA_0329     GOG: -------     Description: hypothetical protein predicted by GeneMar TA        tg T  A      t  t TA       t  t TA        cg AT        ta AA        cg A  A       ta A  c       tg Gc        gc Ta        at G  a       cg At        cg Ag        gc Aa        at             tttatttttttataatagctataagggggctatactcATG     ..................................................................................................................