Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:55 nt.    Distance to gene:117 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-10.00 kcal/mol
Antiterminator:    Distance from promoter:28 nt. Size=32 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCT-TAAGAA. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCTTAAACAATGGCTTAGATAAGAACGGAAAAACAGTTTTTAAGAACAAACAATT
TAAGCGCGTAAAAACAAACGCAAACTTAGAGCAAATACAAACCGTAGCTCGTGCTCTA
GCTTCTTTACAAGCATCACCACTTCACGCTGTACAACTTGTTAGCACATCAGATCTTT
CTAGCCTATAAggtgaaactttaatcaacactcacagctcgatcaataaaaaggaggaaataacatATG

    BA_0338


Gene: BA_0338     GI: 21397713     BI number: BA_0338     GOG: -------     Description: hypothetical protein predicted by GeneMar


  A
A  A
A  A
G  C
G  A
 CG
 AT
 AT
 GT
 AT
 AT
 TA
|  A
|  G
|  A
|  A                  A
|  C                A  C
|  A       AA       A  C
|  A      A  C       CG
|  A      A  A       AT
|  C      A  A       TA
|  A       TA       |  G
|  A       GC       |  C
 AT        CG       |  T
 GT        GC       A  C
 AT       |  A      A  G
 TA       |  A       AT
 TA       C  A       CG
 CG        GC        GC
 GC        AT        AT
|  G       AT        GC
 GC        TA        AT
 TG        TG        TA
 AT        TA        TG
                        CTTCTTTACAAGCATCACCACTTCACGCTGTACAACTTGTTAGCACATCAGATCTTTCTAGCCTATAAggtgaaactttaatcaacactcacagctcgatcaataaaaaggaggaaataacatATG


    ..................................................................................................................