                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:201 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-19.60 kcal/mol
Antiterminator: Size=56 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGATTGTTGTATTGATTGCAAAGTTCTTACCTGGTTTGCCTGTATAAtaatatgattgaatt
aaaaggtggctcttcggagtcaccttttttatttttacccctatttcaaataccactaacagaatttcaaattctacttcatgtaatttcaaatttcagt
gatagtatttaaaattacccacagtgaaatcctttctttatttttatattgtgaaggtaccgcggaatattagaaaggtataccttttagaaacgggtac
tgtgtgaaaccagcgacttttaaagaggcagttgtgTTG

    BA_0341 Gene: BA_0341     GI: 21397716     BI number: BA_0341     GOG: -------     Description: sigma70, Sigma-70 facto At A  a Ta At Ta Gt Tg C  a C  t Gt Tg Ta Ta Gt |  t |  a |  a       tc G  a      t  g Ta        cg Cg        ta Cg        cg At        gt Tg        gc Tg        ta C  c       gc T  t       gc T  |       at Gc        at At        at At        at             ttatttttacccctatttcaaataccactaacagaatttcaaattctacttcatgtaatttcaaatttcagtgatagtatttaaaattacccacagtgaaatcctttctttatttttatattgtgaaggtaccgcggaatattagaaaggtataccttttagaaacgggtactgtgtgaaaccagcgacttttaaagaggcagttgtgTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:208 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-15.30 kcal/mol Antiterminator: Size=56 nt.     Delta G= -5.10 kcal/mol Anti-antiterminator:   Size=27 nt.     Delta G= -5.16 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGCGATTGTTGTATTGATTGCAAAGTTCTTACCTGGTTTGCCTGTATAAtaatatgattgaatt aaaaggtggctcttcggagtcaccttttttatttttacccctatttcaaataccactaacagaatttcaaattctacttcatgtaatttcaaatttcagt gatagtatttaaaattacccacagtgaaatcctttctttatttttatattgtgaaggtaccgcggaatattagaaaggtataccttttagaaacgggtac tgtgtgaaaccagcgacttttaaagaggcagttgtgTTG     BA_0341 Gene: BA_0341     GI: 21397716     BI number: BA_0341     GOG: -------     Description: sigma70, Sigma-70 facto            at           g  t            tg            aa            ta            at            at           t  a           A  a            Aa            Ta            Ag            Tg            Gt           |  g           |  g   G       |  c T  A      T  t T  C       Cc g  C       Ct t  T       Gt        tc g  G       Tc       t  g t  G       Tg        cg t  T       T        ta gT       G         cg aT       G         gt cG       T  |       gc gC        C        ta gC        C        gc aT        A        gc                         ttttttatttttacccctatttcaaataccactaacagaatttcaaattctacttcatgtaatttcaaatttcagtgatagtatttaaaattacccacagtgaaatcctttctttatttttatattgtgaaggtaccgcggaatattagaaaggtataccttttagaaacgggtactgtgtgaaaccagcgacttttaaagaggcagttgtgTTG     ..................................................................................................................