                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:92 nt.    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-13.20 kcal/mol
Antiterminator:    Distance from promoter:35 nt. Size=68 nt.     Delta G=-13.60 kcal/mol
Anti-antiterminator:    Distance from promoter:50 nt.    Size=20 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-aatgat. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGTGACTAAGTAAtaagtaatgattcaacttctttagacaaagtgctaaaggtcacgaagtttgggcacaatatgtaacggatt
atttcgttgcgaagtaataaaggtacacaaaaggtatacgagcaatcgtataccttttataataagagagtgaataagaaatcctaatatatgtaggagg
aagactATG

    BA_0353 Gene: BA_0353     GI: 21397728     BI number: BA_0353     GOG: COG1087     Description: Epimerase, NAD dependent epimerase/dehydratase famil             t           t  g            gc            cg            ta            ta            tg            at            ta            ta            at           |  a           g  a           g  a           c  g           a  g            at            ta            gc            ta           a  c           t  a           a  a           a  a           c  a           a  g       ca ta        cg       g  a t  t       gt        at at       |  a       gc gt       |  t       cg gc       g  a       at cg        gc        ta at        tg        at at        ta        ta tg        tg        gc gc        gc        gc                         ttttataataagagagtgaataagaaatcctaatatatgtaggaggaagactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1087 UDP-glucose 4-epimerase ... can be seen here     ..................................................................................................................