Gene putatively regulated by attenuation in B_anthracis_A2012
Characteristics of the secondary structures
Terminator: Distance from promoter:58 nt. Distance to gene:126 nt. Distance to run of Ts=0 nt. Size=30 nt. Delta G=-13.00 kcal/mol
Antiterminator: Distance from promoter:51 nt. Size=22 nt. Delta G= -3.50 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttgttt-tacatt. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttgttttattcactttatattattacattgccagtaagaaagaggttccccaccatcaattgttagaagaagagtttgaacgagaagaatgacgcctttt
tgttatagggcgttattttttatgattcacgcttatacatgagagaaatcaatgtcatagtaagaagtgttgatgaaaagatgatataatgcttacttgt
tagaaataatttgtgtataaattgtaatgaattagaggaggaagcaaATG
BA_0375
Gene: BA_0375 GI: 21397750 BI number: BA_0375 GOG: ------- Description: hypothetical protein predicted by GeneMar
gt
t t
t a
t t
ga ta
t c tg
a g cg
a c cg
gc gc
at cg
at at
gt gt
at ta
gt at
cg at
ttttatgattcacgcttatacatgagagaaatcaatgtcatagtaagaagtgttgatgaaaagatgatataatgcttacttgttagaaataatttgtgtataaattgtaatgaattagaggaggaagcaaATG
..................................................................................................................