                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:81 nt.    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-13.60 kcal/mol
Antiterminator:    Distance from promoter:27 nt. Size=73 nt.     Delta G= -9.11 kcal/mol
Anti-antiterminator:    Distance from promoter:8 nt.    Size=57 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAGTA-TAGTAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAGTAGAGGGCGCTGGGTTTAGTAGTATTAGTGGACATATGATAAATGTTGGAGCTT
GGCTTATTATTTCACTTATTGCATGTTTAATCGTATATAAAAAGAAACAATTAGACTA
Aaaactgagccgaagcgctcagttttttcttttttctatcatttcctcggaaattttgcaattcctatacatatttttacagattttgtcgaaaagtaat
tagttatacgttgtataggatacgtgaatattgttcaaaatgattgctgaggtgatgatggaATG

    BA_0376 Gene: BA_0376     GI: 21397751     BI number: BA_0376     GOG: COG0739     Description: Peptidase_M37, Peptidase family M23/M3            AA           A  A           T  A           A  G           T  A           A  A            TA            GC           C  A            TA   T        AT A  T       AT T  A       TA T  T       TG C  T       TA GT        GC GC       T  T TA       A  A T  |      C  A C  |      G  a GC       T  a AT       T  a GT       A  c |  A      T  |       aa G  T      T  |      g  g T  T      C  |      c  c TG       A  |       cg GC       C  |       gc TA       T  |       at AT       T  |       gc |  G      T  |       ta |  T      A  |       cg |  T      T  |       at A  T      T  |       at A  A       At        at TA        Tg        At AT        Ta        At GC        Cg       T  | TG        Gc       C  | AT        Gc        At TA        Tg        Gc AT        Ta        At                         tttttctatcatttcctcggaaattttgcaattcctatacatatttttacagattttgtcgaaaagtaattagttatacgttgtataggatacgtgaatattgttcaaaatgattgctgaggtgatgatggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0739 Membrane proteins related to metalloendopeptidases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:50 nt.    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-10.20 kcal/mol Antiterminator:    Distance from promoter:12 nt. Size=73 nt.     Delta G= -9.11 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ATGATA-TATTAT. It has a score value of 61.58 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATGATAAATGTTGGAGCTTGGCTTATTATTTCACTTATTGCATGTTTAATCGTATATA AAAAGAAACAATTAGACTAAaaactgagccgaagcgctcagttttttcttttttctatcatttcctcggaaattttgcaattcct atacatatttttacagattttgtcgaaaagtaattagttatacgttgtataggatacgtgaatattgttcaaaatgattgctgaggtgatgatggaATG     BA_0376 Gene: BA_0376     GI: 21397751     BI number: BA_0376     GOG: COG0739     Description: Peptidase_M37, Peptidase family M23/M3 tg c  a a  g a  c a  c A  g Aa Ta C A G A T T A A C A A A G   A   A   A  | A  | A  | T  | A  | T  | A  | T  | G  |       aa C  |      g  g T  |      c  c A        cg A        gc T        at T        gc T        ta G        cg T        at A        at             ttttcttttttctatcatttcctcggaaattttgcaattcctatacatatttttacagattttgtcgaaaagtaattagttatacgttgtataggatacgtgaatattgttcaaaatgattgctgaggtgatgatggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0739 Membrane proteins related to metalloendopeptidases ... can be seen here     ..................................................................................................................