Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:41 nt.    Distance to gene:171 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-17.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACT-TACAAC. It has a score value of 62.25 and is shown in blue

TTGACTTTAAACGTGCAGAAATGGCATTACAACGTGCTGTGAACCGTTTAAACGTTTC
CGATATGAAATAAaaaaaaccgtaaaggctttgcctttacggtttttttatggataattttacaaaaatgggtatacttatgttgatgctt
gtataagtagagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnaaatgttacgagaagcaTTG

    BA_0400


Gene: BA_0400     GI: 21397775     BI number: BA_0400     GOG: COG5523     Description: hypothetical protein predicted by GeneMar


           t
         t  t
          cg
          gc
          gc
          at
          at
          at
          ta
          gc
          cg
          cg
          at
          at
          at
            ttttatggataattttacaaaaatgggtatacttatgttgatgcttgtataagtagagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaatgttacgagaagcaTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG5523 Predicted integral membrane protein ... can be seen here

    ..................................................................................................................