                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACAATGTTAATGGCAATCTTCACTGTTCATGGAAAAAATGGTTACTGGGTAACCCAAA
ACGGATATGAATACAACTTAATGTTAATCGCAGTTGCGATTGGTGTAGCTTTAATCGG
GCCTGGCGCATACGTTTTACTATAAtttttatcttgaatccgagattgtttagatggaacttacttcaataataatgaagta
agttctttttatgtaataaaaatattattttcagcaggagttttccactaacatcttgtaaacaaacaataagtcgtcatatttagaaaggggatttcaa
gcATG

    BA_0420 Gene: BA_0420     GI: 21397795     BI number: BA_0420     GOG: COG1853     Description: Flavin_Reduct, Flavin reductase like domai ag g  a c  t c  t tg         a at       a  t at       t  a gt       a  a t  |       at ta        cg cg        ta ta        ta at        cg tg        at tg        ta ta        ta ta        cg t  c       at At        at At        gc Ta        gt             ttttatgtaataaaaatattattttcagcaggagttttccactaacatcttgtaaacaaacaataagtcgtcatatttagaaaggggatttcaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1853 Conserved protein/domain typically associated with flavoprotein oxygenases, DIM6/NTAB family ... can be seen here     ..................................................................................................................