                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=2 nt.   Size=37 nt.     Delta G=-18.10 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -4.41 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTCGACAATTGTACTTACTAACAAATCATCCACAATCTATAACAATCTTTCAGTTTT
TTGACTTTGTTACTATAGAGAAAGAAAACGTACCAGAGGGAATTCGACAGTTAGAACA
CTTTTGTAAAAATATAAAAGAGCCAAATGCAATAATACTAAATTGTCAGCTATTCACA
AAGTTATCCACGGATTAAttaggtttatccacattttgtggataaaccttgtttgtcttttggataaatctcatagtaaactaaaaa
tagacaagtatttcagggtagaaaaggacgtgggaaaaaATG

    BA_0423 Gene: BA_0423     GI: 21397798     BI number: BA_0423     GOG: COG0009     Description: Sua5_yciO_yrdC, yrdC domai CA T  C T  A A  A TA CG GT AT |  A |  T |  C |  C |  A |  C |  G CG TA GT T  T T  A A  A        t At       t  t At       a  t Ta        cg Cg        at A  g       cg T  t       cg At        ta At        at Ta        ta At        ta |  c       ta A  c       gc C  a       gc Gc        at Ta       t  t At        tg At        At At        At             tgtcttttggataaatctcatagtaaactaaaaatagacaagtatttcagggtagaaaaggacgtgggaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0009 Putative translation factor (SUA5) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.90 kcal/mol Antiterminator: Size=70 nt.     Delta G= -4.41 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATTCGACAATTGTACTTACTAACAAATCATCCACAATCTATAACAATCTTTCAGTTTT TTGACTTTGTTACTATAGAGAAAGAAAACGTACCAGAGGGAATTCGACAGTTAGAACA CTTTTGTAAAAATATAAAAGAGCCAAATGCAATAATACTAAATTGTCAGCTATTCACA AAGTTATCCACGGATTAAttaggtttatccacattttgtggataaaccttgtttgtcttttggataaatctcatagtaaactaaaaa tagacaagtatttcagggtagaaaaggacgtgggaaaaaATG     BA_0423 Gene: BA_0423     GI: 21397798     BI number: BA_0423     GOG: COG0009     Description: Sua5_yciO_yrdC, yrdC domai AA T  t T  t A  a Gg Gg Ct At |  t |  a |  t |  c |  c |  a |  c Ca Ct Tt A  t T T G A A A C          t A        t  t C       a  t T        cg T        at A        cg |         cg T         ta C         at G        ta A        ta C        ta T        gc G        gc             ttgtttgtcttttggataaatctcatagtaaactaaaaatagacaagtatttcagggtagaaaaggacgtgggaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0009 Putative translation factor (SUA5) ... can be seen here     ..................................................................................................................