Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=57 nt.     Delta G= -4.63 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAAGAAAGTTGTAAAGCAGGAAGTCGCAACAAAAGTAACAGCTTCTGAAAAGAAAGT
AGTAAAAAATGAAACAAAAGTAGAAGAACAACCTGTAAGTAAAGAGGAAACAAAAACT
GTGGAAAAAGTGGAGAAACCTGTGGAGCKAAAACAAGAAAAACAAAATGAGTATGTAA
AAGTAGAAGAGGAAGAAGAAGAGCCAGAAGTTAAGTTATTTATTGTAGAAGCTTTTAC
ATCTTTATTCTCTAAATAGtactattcgtaaatcccttctcatatataaaaaagaggagggatttattATG

    BA_0424


Gene: BA_0424     GI: 21397799     BI number: BA_0424     GOG: -------     Description: hypothetical protein predicted by GeneMar


            A
          T  A
          C  A
          T  T
          C  A
          T  G
          T  t
  A       A  a
T  T      T  c
T  T      T  t
 TG       T  a
 AT       C  t
 TA       T  t
 TG       A  c
G  A       Cg
A  |       At        ta
A  |       Ta       a  a
 TA        Ta       t  a
 TG        Ta       a  a
 GC       |  t      t  a
 AT       T  c      a  a
 AT       C  c       cg
 GT        Gc        ta
 AT        At        cg
C  A       At        tg
C  C       Gc        ta
G  A       At        cg
 AT       T  |       cg
 GC        Gc        cg
 AT        Ta        ta
                        tttattATG


    ..................................................................................................................