                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-15.80 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTATCGCCGCTTTATGGAAGAATTGCCGAATGTGCTGCAGAAGAAAGCAATTGTAGC
ATTTGAAATAGGAGTAGGGCAAGGTGAGGACGTGAAAGGGCTGTTACAACAAGCTTTT
CCACATGCTCATGTTGAGGTTGTTTTTGATATTAATGGAAAAGATCGTATGGTATTTG
CAGAAATAGAGTAAggattacaccttactctatttttttgtggaaaaattcatatagattttgaatttaatagtttagaaagatgaaagt
ctgtccacactgtttgtagaagggacggtggaggaaATG

    BA_0425 Gene: BA_0425     GI: 21397800     BI number: BA_0425     GOG: NOG07099     Description: hypothetical protein predicted by GeneMar CA G  G TA        ta TA       t  c TA       a  a AT        gc TA        gc G  G       At G  A       At TG        Ta AT        Gc TA        At |  A       Gc G  g       At Cg        Ta Ta        At At        At Gt        At             ttttgtggaaaaattcatatagattttgaatttaatagtttagaaagatgaaagtctgtccacactgtttgtagaagggacggtggaggaaATG     ..................................................................................................................