                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=60 nt.     Delta G=-12.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCTTGGCTTGAATCGGAAGGGCTTCCGTATGGGAAAGAGTCAGCGATGTCAAAAGT
ATTTGCAGGCGATGCAGCGATGAAGGTGACGACGGAAGCGGTACAAGTATTTGGTGGT
TACGGTTATACGAAAGATTATCCAGTAGAGCGTTATATGCGGGATGCAAAGATTACAC
AGATATATGAAGGAACGCAAGAGATTCAAAGGCTCGTAATTTCTCGTATGTTAACGAA
GTAGgatcgaaggcgtaggtattttcctacgctttttccttccaaaaaataatagaggggtgaaggggATG

    BA_0441 Gene: BA_0441     GI: 21397816     BI number: BA_0441     GOG: COG1309     Description: tetR, Bacterial regulatory proteins, tetR famil   C T  G C  T T  A T  T TG AT AT |  A TA GC CG |  A TA CG GT G  A A  | A  | A  | CG Tg Ta At        tt Gc       a  t A  g      t  t G  a       gc A  a       gc A  g       at Cg        ta Gc        gc Cg        cg At        gc             tttttccttccaaaaaataatagaggggtgaaggggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1309 Transcriptional regulator ... can be seen here     ..................................................................................................................