                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-12.50 kcal/mol
Antiterminator:    Distance from promoter:75 nt. Size=32 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:    Distance from promoter:43 nt.    Size=44 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCAAC-TACGTT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAACTCGCGCAAAAACAAGGGTACGTTTTCCGCCCTTATACCATTAACGAATACAA
AGATTTACAAACTATGTTGGATTATGGCGTAGATGTCATTATTACCGATTGGCCAGCA
CGCGCCTTTGAGCTCCTTTCTTAAttgaaggagctttttgttttcaaaatttcattgtttaaaataaccgaaaaccctcaat
actaatacaataatgtttgtatgaatgaggggctgaaaaagATG

    BA_0478 Gene: BA_0478     GI: 21397853     BI number: BA_0478     GOG: COG0744     Description: Transglycosyl, Transglycosylas CA T  T GT TA AT GT A  A       CC T  C      G  T GC       C  T CG        GT         A G  A       CG       T  A G  T      A  A      T  t T  |       CG       C  t AT        GC        Tg TG        AT        Ta TG       C  |       Ta A  |      C  |       Cg GC        GC        Cg GC        GC        Ta TA       T  T       Cg TG       T  T       Gc GC        AT        At TA        GC        Gt                         tttgttttcaaaatttcattgtttaaaataaccgaaaaccctcaatactaatacaataatgtttgtatgaatgaggggctgaaaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0744 Membrane carboxypeptidase (penicillin-binding protein) ... can be seen here     ..................................................................................................................