Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:103 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.50 kcal/mol
Antiterminator: Size=76 nt.     Delta G=-12.01 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAATTCCAAGAAGAATCAATTTGGAAAAATATGAACGCTGTTAAAAACAACCACGTA
TTTACAATTAAAAACGAAGAATTAAACAAAGGTTACTTCCCACTAGGTAAAGAAATGA
TCTTAGATGAAGTTGCTGAGTTCGTTTTAGGGAAATAAtgtataaaaagagatcacttttactccggtaaag
gtgattttttctttttataaaggcaattcatatagtctttcatttctttctgtttcctatttcgtttataatatatagtaagaatgcagtaaagaaaggg
ggatgtcggaaaGTG

    BA_0483


Gene: BA_0483     GI: 21397858     BI number: BA_0483     GOG: COG1078     Description: HD, HD domai


            a
          g  t
          a  c
           ga
           ac
           at
           at
           at
          a  t
           ta
           ac
          t  t
          g  c
          t  c
          A  g
           A
           T
          A
           A
           A
          |
          |
          |
          |
          |
  A       |
A  G      |
G  T       G
T  T       G
A  G       G
 GC        A        cc
 AT        T       t  g
 TG        T        cg
 TA       T         at
 CG       T  |       ta
T  T      G  |       ta
 AT        C        ta
 GC        T        tg
 TG        T        cg
 AT        G        at
 AT        A        cg
 AT        G        ta
 GT        T        at
                        tttttctttttataaaggcaattcatatagtctttcatttctttctgtttcctatttcgtttataatatatagtaagaatgcagtaaagaaagggggatgtcggaaaGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG1078 HD superfamily phosphohydrolases ... can be seen here

    ..................................................................................................................