                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-13.90 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGACGGTAGTAACAGTATGAAAGTTACTGCAAAAACGACAGAAGAAGTTGAAAAAGCA
AATTGGTTTGTTTTAACAATGCGCTCTATTGGAGATTTCTTCTCAAACTTATGGTCTA
AAGTTTTTTAAtaaaaaagctggctcacgctagctttttttattttccactctcattgtaaaacttcgtttggttgtcatatctgagtcctt
tttctcatacgtatgaactagtaattgttacacacttcatctagagataaacctctttccacaaggtattccaaaaagagaggtgacacataATG

    BA_0496 --- BA_0497 Gene: BA_0496     GI: 21397871     BI number: BA_0496     GOG: COG3773     Description: hypothetical protein predicted by GeneMark Gene: BA_0497     GI: 21397872     BI number: BA_0497     GOG: NOG13472     Description: hypothetical protein predicted by GeneMar At A  a Ta Ta        ca Ta       t  c Ta        cg Ta        gc Tg        gt Gc        ta At        cg A  |       gc A  |       at T  |       at Cg        at Tg        at Gc        at Gt        at             tattttccactctcattgtaaaacttcgtttggttgtcatatctgagtcctttttctcatacgtatgaactagtaattgttacacacttcatctagagataaacctctttccacaaggtattccaaaaagagaggtgacacataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3773 Cell wall hydrolyses involved in spore germination ... can be seen here     ..................................................................................................................