                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:209 nt.     Distance to run of Ts=3 nt.   Size=26 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGGGATGGGTGTTATGTTAGCGTCATTAATTGCAGGTGGCATTTTAAGCTCATTCGC
AACATCTTGGGAAGGTGCGAAATATATTTTTAGTGTGAATTTATCATTAACAGATTAT
CTATCAGGAAAACTACCTGCATTACAAGGTTTATCGATGGGGTTTTCTTTAATGAATT
TAACTGTTTGGGGAATTGTATCTCTTATTATTTCATTTGTAGTATTTACAAAGCAGGA
TATGGTGAATTAAttagacgggaagtgaaagtgtgaaacatgttttgaaaaatgattgggggccgttaTTG

    BA_0505 Gene: BA_0505     GI: 21397880     BI number: BA_0505     GOG: COG0692     Description: UNG, Uracil-DNA glycosylas   g g  g gc gc t  | tg at gt ta aT         T aT       T  T |  G      T  A a  T      A  A       TG a  T       CG       T  G a  G       GC        CG gC       |  T       TA tA        GC       A  A tG        TA       C  G |  G       GT       A  G |  T      G  T       AT tG       A  C       CG tG        CG        GC gC        GC        CG tA        TA        TA aT        TA        TA                         ATATATTTTTAGTGTGAATTTATCATTAACAGATTATCTATCAGGAAAACTACCTGCATTACAAGGTTTATCGATGGGGTTTTCTTTAATGAATTTAACTGTTTGGGGAATTGTATCTCTTATTATTTCATTTGTAGTATTTACAAAGCAGGATATGGTGAATTAAttagacgggaagtgaaagtgtgaaacatgttttgaaaaatgattgggggccgttaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0692 Uracil DNA glycosylase ... can be seen here     ..................................................................................................................