                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:98 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-13.40 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-14.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATATTTACGATTTTCTGTGGATCCATTTTAATAGGCGTATTTGCTGTAATTATACTT
GGGCAAGAAACGAAACAACGAGAATTAGTATAAgatgaggctttaatcagtgagggggttattcccacgctgatta
ttggtccttaccgatagtggaataaaaaggcagggggaaccgtgaaggtttccttttttctgtttttttagataaataatggtatagtaagaaaaaggga
atgttctttataaaagcgaatgtatacaacaggacatacggacaaaagaattaggtggttgaagaaATG

    BA_0526 Gene: BA_0526     GI: 21397901     BI number: BA_0526     GOG: COG3279     Description: REC, cheY-homologous receiver domai ct c  t ta gc gc tg ta at ta tg at                   g |  g                t  a |  g                g  a |  a                 cg |  a                 cg |  t                 at |  a                 at |  a                 gt |  a                 gc |  a                 gc g  a                 gt tg                 |  t cg                 |  t gc                 |  t c  a       ga       |  t a  g      g  a      |  t cg        gc        gc cg        gc        at cg       g  g       cg tg        at        gt ta        cg        gt                         tttttagataaataatggtatagtaagaaaaagggaatgttctttataaaagcgaatgtatacaacaggacatacggacaaaagaattaggtggttgaagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KT] COG3279 Response regulator of the LytR/AlgR family ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.20 kcal/mol Antiterminator: Size=14 nt.     Delta G= -4.70 kcal/mol Anti-antiterminator:   Size=33 nt.     Delta G=-15.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AATATTTACGATTTTCTGTGGATCCATTTTAATAGGCGTATTTGCTGTAATTATACTT GGGCAAGAAACGAAACAACGAGAATTAGTATAAgatgaggctttaatcagtgagggggttattcccacgctgatta ttggtccttaccgatagtggaataaaaaggcagggggaaccgtgaaggtttccttttttctgtttttttagataaataatggtatagtaagaaaaaggga atgttctttataaaagcgaatgtatacaacaggacatacggacaaaagaattaggtggttgaagaaATG     BA_0526 Gene: BA_0526     GI: 21397901     BI number: BA_0526     GOG: COG3279     Description: REC, cheY-homologous receiver domai ta t  t gt gc gc gc                   g g  a                t  a a  |                g  a gc                  cg tg                  cg gc        tg        at at       t  g       at cg        at        gt ta        tc        gc at       t  c       gc at        at        gt ta        gt        gt                         ttttctgtttttttagataaataatggtatagtaagaaaaagggaatgttctttataaaagcgaatgtatacaacaggacatacggacaaaagaattaggtggttgaagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KT] COG3279 Response regulator of the LytR/AlgR family ... can be seen here     ..................................................................................................................