                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:147 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -3.62 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGTCGCTGCTGCAACATTCCGTATGACACAAAATATTTCTAATGATAAACGCAAAT
TCCATGCAAATCGCTTACGCGGAATTGTTCGTGGATATTTAAAATAAaaaataaggtgtaaccac
ttatataaaatggttataccttatttttatttctctcacatcacagcaatccatcatccttttgtcatcgtataccctactattcaattacattatatat
tttggaaatgatagcattctacccaagaatttagtatcatgattcaagacactatttagaaatgaacggaggacattATG

    BA_0537 Gene: BA_0537     GI: 21397912     BI number: BA_0537     GOG: COG0488     Description: ABC_tran, ABC transporte             A           A  a           T  a           A  a           A  a TA       A  t        a T  C      A  a      t  t CG        Ta       a  a GC        Tg        ta CG        Tg        ta TG        At       c  a |  A       Tg        at A  A       At        cg AT       |  a       cg AT       |  a       at CG        Gc        at GT        Gc        ta |  T       Ta        gt |  C       Gc        ta TG       C  t       gc AT       T  t       gc CG        Ta        at CG        Gt        at TA        Ta        ta                         tttttatttctctcacatcacagcaatccatcatccttttgtcatcgtataccctactattcaattacattatatattttggaaatgatagcattctacccaagaatttagtatcatgattcaagacactatttagaaatgaacggaggacattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................