                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:84 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-21.70 kcal/mol
Antiterminator:    Distance from promoter:77 nt. Size=16 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggaat-tatgak. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggaatggaatgtggaatatctttatgaktartaaacattcccgggtgaagagccgttatttctacttgagaggaaggcggtaatgcttttcactagggt
ggcaacgcgggttaactcccgtcccyttatatagggacgggagttttttgtgttttataaaataaanggaggagtatataATG

    BA_0607 Gene: BA_0607     GI: 21397982     BI number: BA_0607     GOG: COG0172     Description: tRNA-synt_2b, tRNA synthetase class II core domain (G, H, P, S and T            at           t  a           t  t           y  a            cg            cg            cg            ta aa        gc t  c       cg t  t       cg gc        cg gc        ta gc        cg cg        at gt        at             ttttgtgttttataaaataaanggaggagtatataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0172 Seryl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:84 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-21.70 kcal/mol Antiterminator:    Distance from promoter:50 nt. Size=16 nt.     Delta G= -7.10 kcal/mol Anti-antiterminator:    Distance from promoter:23 nt.    Size=30 nt.     Delta G= -8.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tggaat-tatgak. It has a score value of 64.26 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agggtggcaacgcg is shown in italic-bold style tggaatggaatgtggaatatctttatgaktartaaacattcccgggtgaagagccgttatttctacttgagaggaaggcggtaatgcttttcactagggt ggcaacgcgggttaactcccgtcccyttatatagggacgggagttttttgtgttttataaaataaanggaggagtatataATG     BA_0607 Gene: BA_0607     GI: 21397982     BI number: BA_0607     GOG: COG0172     Description: tRNA-synt_2b, tRNA synthetase class II core domain (G, H, P, S and T   t                  at t  g                t  a c  a                t  t a  g                y  a ta                  cg cg                  cg tg                  cg ta                  ta ta        ct        gc a  |      g  t       cg tg       t  t       cg tg        at        cg gc        ac        ta cg        ta        cg cg        gc        at gt        gt        at                         ttttgtgttttataaaataaanggaggagtatataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0172 Seryl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................