                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAAAAAAACTAnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnagtggcggagggactggccctctgatgcccggcaaccgagcttatgacgtataagctaaggtgctaattcctgcaaaatga
gttttcgttttggaagataagagaggatcctattttgtctattcggcacctctcttatttttgagaggtgctttttattttggaacatatatgaaggggg
aactatagATG

    BA_0758 --- BA_0757 --- BA_0756 Gene: BA_0758     GI: 21398133     BI number: BA_0758     GOG: COG1464     Description: hypothetical protein predicted by GeneMark Gene: BA_0757     GI: 21398132     BI number: BA_0757     GOG: COG1135     Description: ABC_tran, ABC transporter Gene: BA_0756     GI: 21398131     BI number: BA_0756     GOG: COG2011     Description: BPD_transp, Binding-protein-dependent transport systems inner membrane componen             t           a  t           t  c            cg            tg            gc            ta           t  |           t  |           t  |           a  |           t  |           c  |       tt at       c  |      a  t g  c      t  |      t  t gc       a  |      t  t at        gc        cg g  a       gc        ta at        at        cg gt        gc        ta at        at        cg at        gc        cg tg        at        at at        at        cg gc        ta        gc at        at        gt                         ttttattttggaacatatatgaagggggaactatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here [P] COG1135 ABC-type metal ion transport system, ATPase component ... can be seen here [P] COG2011 ABC-type metal ion transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012 This operon is putativelly rgulated by Methionine_S-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-12.70 kcal/mol Antiterminator: Size=26 nt.     Delta G= -6.90 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G= -7.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TAAAAAAACTAnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnagtggcggagggactggccctctgatgcccggcaaccgagcttatgacgtataagctaaggtgctaattcctgcaaaatga gttttcgttttggaagataagagaggatcctattttgtctattcggcacctctcttatttttgagaggtgctttttattttggaacatatatgaaggggg aactatagATG     BA_0758 --- BA_0757 --- BA_0756 Gene: BA_0758     GI: 21398133     BI number: BA_0758     GOG: COG1464     Description: hypothetical protein predicted by GeneMark Gene: BA_0757     GI: 21398132     BI number: BA_0757     GOG: COG1135     Description: ABC_tran, ABC transporter Gene: BA_0756     GI: 21398131     BI number: BA_0756     GOG: COG2011     Description: BPD_transp, Binding-protein-dependent transport systems inner membrane componen tt g  t a  t                  t gc                 a  t tg                 t  c at                  cg at                  tg at                  gc at                  ta cg                 t  | |  g                t  | g  a                t  | ta                 a  | cg                 t  | |  a       at       c  | |  t      g  c      c  | c  a       gc       t  | t  a       at       a  | t  g      g  a       gc a  a       at        gc a  g       gt        at ta        at        gc cg        at        at g  g       tg        gc ta        at        at gt        gc        at gc        at        ta                         tttttgagaggtgctttttattttggaacatatatgaagggggaactatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here [P] COG1135 ABC-type metal ion transport system, ATPase component ... can be seen here [P] COG2011 ABC-type metal ion transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................