                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:155 nt.    Distance to gene:29 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G=-18.70 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=77 nt.     Delta G=-23.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tataca-taaaat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tatacatgcttttgtttgttcaataaaataaatcatgctacaatgaaaacgaattaaggaccggggagccaattggctgagaggatgtgagcaaacatcg
accctcaacctgatctggataatgccagcgtagggagttacttaaagtaatgtagcatatgttattctataataacttgcatacaaggctttcctacgtg
gtaggaaagccttttcttgttttaaaatttaatttcataagggggattttattATG

    BA_0956 --- BA_0957 --- BA_0958 --- BA_0959 Gene: BA_0956     GI: 21398331     BI number: BA_0956     GOG: COG0011     Description: DUF77, Protein of unknown function DUF77 Gene: BA_0957     GI: 21398332     BI number: BA_0957     GOG: COG0600     Description: hypothetical protein predicted by GeneMark Gene: BA_0958     GI: 21398333     BI number: BA_0958     GOG: COG0715     Description: hypothetical protein predicted by GeneMark Gene: BA_0959     GI: 21398334     BI number: BA_0959     GOG: COG1116     Description: ABC_tran, ABC transporte ta c  t ta ta at ta ta gc t  t a  | t  | at cg gc |  a at ta gc ta a  a a  g tg gc at a  | a  | t  | t  | c  | a  | t  |        t t  |      g  g g  |       cg at        at gt        ta gc        cg gc        cg at        ta ta        ta gc        ta cg        cg g  |       gc at        gc cg        at cg        at             ttcttgttttaaaatttaatttcataagggggattttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0011 Uncharacterized conserved protein ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................