                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-13.00 kcal/mol
Antiterminator:    Distance from promoter:61 nt. Size=40 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:    Distance from promoter:21 nt.    Size=43 nt.     Delta G= -7.12 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tgtgct. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaccactaggggtgcttgttgtgctgagagaggaataatccttaacccttataacacctgatctaggtaatactagcgaagggaagtggaacaacg
aataaattataattttatttgctgtaaccacttcttatatwaagaagtggttttttatttatatacacataccggaaggggatagagaaATG

    BA_1313 --- BA_1314 --- BA_1315 --- BA_1316 Gene: BA_1313     GI: 21398688     BI number: BA_1313     GOG: COG0819     Description: TENA_THI-4, TENA/THI-4 family Gene: BA_1314     GI: 21398689     BI number: BA_1314     GOG: COG1116     Description: ABC_tran, ABC transporter Gene: BA_1315     GI: 21398690     BI number: BA_1315     GOG: COG0600     Description: hypothetical protein predicted by GeneMark Gene: BA_1316     GI: 21398691     BI number: BA_1316     GOG: -------     Description: PBPb, Bacterial periplasmic substrate-binding protein aa t  t g  a        t gc       a  a at       t  a ta       t  t cg        at t  c       at a  g       at g  a       ta         a ta        at       t  t cg        at       a  w cg        gt        ta a  g       cg        ta c  a      a  c       cg a  a       at        ta a  g       cg        ta t  t       at        cg a  |      |  a       at t  |      a  a       cg t  |       gc        cg cg        gc        at cg        ta        at                         ttttatttatatacacataccggaaggggatagagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012 This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:203 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-18.50 kcal/mol Antiterminator: Size=46 nt.     Delta G=-12.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttattacctgatctagattatgctagcgtagggaagcaattcggacactaataatgagtccccgtttctttgcgtatagaaacggggcttttttatttg aaaatttcatattgaaaccactaggggtgcttgttgtgctgagagaggaataatccttaacccttataacacctgatctaggtaatactagcgaagggaa gtggaacaacgaataaattataattttatttgctgtaaccacttcttatatwaagaagtggttttttatttatatacacataccggaaggggatagagaa ATG     BA_1313 --- BA_1314 --- BA_1315 --- BA_1316 Gene: BA_1313     GI: 21398688     BI number: BA_1313     GOG: COG0819     Description: TENA_THI-4, TENA/THI-4 family Gene: BA_1314     GI: 21398689     BI number: BA_1314     GOG: COG1116     Description: ABC_tran, ABC transporter Gene: BA_1315     GI: 21398690     BI number: BA_1315     GOG: COG0600     Description: hypothetical protein predicted by GeneMark Gene: BA_1316     GI: 21398691     BI number: BA_1316     GOG: -------     Description: PBPb, Bacterial periplasmic substrate-binding protein   t a  a a  a t  t c  g a  a cg at        cg gc       g  t gc       t  a c  c      t  t t  c       ta t  |       cg a  |       ta a  |       ta cg        ta gt        gc at        cg at        cg gc        cg gt        cg gt       t  | at        gc tg        at gc        gt             ttttatttgaaaatttcatattgaaaccactaggggtgcttgttgtgctgagagaggaataatccttaacccttataacacctgatctaggtaatactagcgaagggaagtggaacaacgaataaattataattttatttgctgtaaccacttcttatatwaagaagtggttttttatttatatacacataccggaaggggatagagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................