                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

aaatttatatgtatgcgatgataaagaagagtacatattgaggcaatttcagagagcttgtggctggtgtgaacaagtaattgtacagtatggaatgggc
ttttgagctccaaaccgaaccgaaagtagtaggctttggcgttatatccaaacgttactatggattagagagatttcacagtagtgaaataattagggtggtaccgcggtccattcgtccctatagttttttgggatgaatgggcttttttgtttgctttctcttccctgtcacgcattcaattttaggaggaattactt
ATG

    BA_1726 Gene: BA_1726     GI: 21399101     BI number: BA_1726     GOG: COG0180     Description: tRNA-synt_1b, tRNA synthetases class I (W and Y gt a  a cg at cg ta ta ta at g  a a  a g  |       gc         t a  |      c  g      g  t gt        cg       a  t at        at       t  t ta       t  |      a  t tg        gc       t  t a  g       gc        cg g  |       ta        cg g  |      |  t       cg tg       |  t       ta at       |  c       gt tg       |  g       cg cg       |  t       ta at        gc        ta ta        gc        at t  c       gc        cg gc        at        cg cg        ta        tg                         cttttttgtttgctttctcttccctgtcacgcattcaattttaggaggaattacttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0180 Tryptophanyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:67 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G= -8.50 kcal/mol Antiterminator: Size=46 nt.     Delta G= -6.62 kcal/mol Anti-antiterminator:   Size=75 nt.     Delta G=-10.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agggtggtaccgcg is shown in italic-bold style aaatttatatgtatgcgatgataaagaagagtacatattgaggcaatttcagagagcttgtggctggtgtgaacaagtaattgtacagtatggaatgggc ttttgagctccaaaccgaaccgaaagtagtaggctttggcgttatatccaaacgttactatggattagagagatttcacagtagtgaaataattagggtg gtaccgcggtccattcgtccctatagttttttgggatgaatgggcttttttgtttgctttctcttccctgtcacgcattcaattttaggaggaattactt ATG     BA_1726 Gene: BA_1726     GI: 21399101     BI number: BA_1726     GOG: COG0180     Description: tRNA-synt_1b, tRNA synthetases class I (W and Y ta t  t g  a c  t gc gc ta ta ta c  c g  g gt at ta gc at ta gt a  | a  |       gt a  |      a  a g  |       cg c  |       at c  |       cg a  |       ta a  |       ta g  |       ta        gc cg        at       c  g cg       |  a       cg a  a      |  a       at at       |  t      t  | at       g  t       gc c  a      a  a       gc cg       g  g       ta ta       a  g      |  t cg       g  g      |  t |  a       at       |  c |  g       tg       |  g |  a       tg       |  t |  t       at        gc gt       |  a       gc at        gc        gc gc        gc        at ta        tg        ta                         tagttttttgggatgaatgggcttttttgtttgctttctcttccctgtcacgcattcaattttaggaggaattacttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0180 Tryptophanyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................