                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:99 nt.    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-11.20 kcal/mol
Antiterminator:    Distance from promoter:34 nt. Size=71 nt.     Delta G=-15.93 kcal/mol
Anti-antiterminator:    Distance from promoter:27 nt.    Size=35 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaat-taagat. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaataaatgtagtactgtcataagatttattttatggagagctatttggagatgttgatgcggtttcttattttgaggagataacaactcgtttattt
tttcaatatatatttttcctaataagaaacgcgtgtgaacattgktccgcgcgttttttgtctatctaaaagcgtgctgcaatgaatagaggattggggt
tatgagttttagaggaaataagggaggaattcaaATG

    BA_1959 Gene: BA_1959     GI: 21399334     BI number: BA_1959     GOG: COG0019     Description: Orn_Arg_deC_N, Pyridoxal-dependent decarboxylase, pyridoxal binding domai            ct           a  c           a  g           c  t            at            at            ta            at            gt            at            gt            gt            at            gc            ta            ta           |  t           |  a           |  t           |  a           |  t           |  a           |  t           |  t tt       |  t t  t      |  t a  g      |  t ta       |  c tg       |  c        t cg       |  t      a  t ta        ta       c  g tg        ta       a  k ta        at        at gt        ta        gc g  a       ta       t  | c  a       cg        gc g  |       ta        tg t  |       ta        gc a  |       ta        cg gc        gc        gc ta       |  g       cg ta        gc        at gc        cg        at                         ttttgtctatctaaaagcgtgctgcaatgaatagaggattggggttatgagttttagaggaaataagggaggaattcaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0019 Diaminopimelate decarboxylase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................