Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:85 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-21.40 kcal/mol
Antiterminator:    Distance from promoter:57 nt. Size=40 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:    Distance from promoter:28 nt.    Size=47 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGATA-TACAAT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGATATGAAATATGGTTCAATTACAATTGTTGTACAAGATGGAAAAGTCATTCAACT
AGAGAAAAGTGAAAAAGTACGTTTAAAGTAAaaagcgctgactagaaaaactagaggcggttttaacctatttcatt
aggttaaaaccgtctttttgcttttacagggggaaaaaacATG

    BA_1961 --- BA_1962 --- BA_1963 --- BA_1964 --- BA_1965


Gene: BA_1961     GI: 21399336     BI number: BA_1961     GOG: COG0175,COG5270     Description: PAPS_reduct, Phosphoadenosine phosphosulfate reductase family
Gene: BA_1962     GI: 21399337     BI number: BA_1962     GOG: COG2046     Description: ATP-sulfurylase, ATP-sulfurylase
Gene: BA_1963     GI: 21399338     BI number: BA_1963     GOG: COG0529     Description: APS_kinase, Adenylylsulfate kinase
Gene: BA_1964     GI: 21399339     BI number: BA_1964     GOG: COG0155     Description: NIR_SIR, Nitrite and sulphite reductase 4Fe-4S domain
Gene: BA_1965     GI: 21399340     BI number: BA_1965     GOG: -------     Description: hypothetical protein predicted by GeneMar


  T
T  A
T  A
G  A
 CG
 AT         a
 TA       a  a
G  A      a  a
A  a       gc        tc
A  a       at       t  a
A  a       ta       t  t
A  g       cg        at
A  |      a  a       ta
 Gc       g  |       cg
 Tg        tg        cg
 Gc        cg        at
 At        gc        at
A  g       cg        ta
A  a      g  g       ta
A  |       at        ta
G  |       at        ta
A  |       at        gc
 Gc        At        gc
 At       A  a       cg
 Ta        Ta        gt
 Cg        Gc        gc
                        tttttgcttttacagggggaaaaaacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[EH] COG0175 3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase and related enzymes ... can be seen here
[J] COG5270 PUA domain (predicted RNA-binding domain) ... can be seen here
[P] COG2046 ATP sulfurylase (sulfate adenylyltransferase) ... can be seen here
[P] COG0529 Adenylylsulfate kinase and related kinases ... can be seen here
[P] COG0155 Sulfite reductase, beta subunit (hemoprotein) ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Methionine_S-box sequence ... can be seen here

    ..................................................................................................................