                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-23.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgtgagcccggtacgataaaatatacagaatgggcttgcgagaggtatgttgaacattgtagtaggcaacccgggttccgccgttaaaaggatagagtat
cggagtttttcctgtacttgaacaagtgggatttatcaatccaattgaggtggtaccacggtattaacattacatatatcgtcctctacatgcatatttg
cgtgtaggggacttttttattttctaaaggaggtgtgcgagtatgaaatgaaagtgtataattaataaaagtttaaatattcagaaaaggggaatttatg
ATG

    BA_1969 Gene: BA_1969     GI: 21399344     BI number: BA_1969     GOG: -------     Description: SNF, Sodium:neurotransmitter symporter famil at t  c ta ta at gc gc         t g  a      a  t t  a      c  a g  |      a  c at       a  a at       t  t       at cg        ta       t  t a  a       at        at a  g       ta        cg g  g       gt        gc t  t       gc        tg tg        cg        at cg        at        cg at       c  c       at ta       c  c       ta gc       a  t       cg |  c      t  |       tg |  a       gc        cg t  c       gt        cg cg        ta        ta cg        gc        gc                         ttttttattttctaaaggaggtgtgcgagtatgaaatgaaagtgtataattaataaaagtttaaatattcagaaaaggggaatttatgATG                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-23.00 kcal/mol Antiterminator: Size=40 nt.     Delta G= -6.70 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G=-10.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tgtgagcccggtacgataaaatatacagaatgggcttgcgagaggtatgttgaacattgtagtaggcaacccgggttccgccgttaaaaggatagagtat cggagtttttcctgtacttgaacaagtgggatttatcaatccaattgaggtggtaccacggtattaacattacatatatcgtcctctacatgcatatttg cgtgtaggggacttttttattttctaaaggaggtgtgcgagtatgaaatgaaagtgtataattaataaaagtttaaatattcagaaaaggggaatttatg ATG     BA_1969 Gene: BA_1969     GI: 21399344     BI number: BA_1969     GOG: -------     Description: SNF, Sodium:neurotransmitter symporter famil at t  c ta ta at gc gc         a g  a      c  t t  a      a  t g  |      a  a at       t  c at       t  a       at cg        at       t  t a  a       ta        at a  g       gt        cg g  g       ga        gc t  t       ct        tg tg        ac        at cg        cg        cg at       c  t       at ta       a  c       ta gc       t  c       cg |  c      g  |       tg |  a       gt        cg t  c       tc        cg cg        gt        ta cg        ga        gc                         ttttttattttctaaaggaggtgtgcgagtatgaaatgaaagtgtataattaataaaagtttaaatattcagaaaaggggaatttatgATG                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................