                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.20 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -8.41 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtatcgcg is shown in italic-bold style

agaacgagtacgttatagaactgtcccccagagagttggcgatttgctgaaagccaacgttcagtgcgtagccgaaaatcatctccgagaagtagaaccg
aatgttgcagtaagttcttaccggctgtcccccgttacaaggaacacgtatcatgttgtacgttgcagagccgtatacatatagactcatttctacatgt
ataaattagggtggtatcgcgggtaaatataactcgtccctttctttagggacgagttttttgtgttcttacaaatgaatgtaaaaaaggaggaaaaaca
ATG

    BA_1981 Gene: BA_1981     GI: 21399356     BI number: BA_1981     GOG: COG1114     Description: hypothetical protein predicted by GeneMar ca t  t c  t at         t gc       a  a at       a  t ta       a  a a  c       ta ta        gc at        gt cg        gc        ct at        cg       t  t ta        gt       t  t at       c  |       ta ta       t  |       cg |  a      a  |       cg |  a      t  |       cg |  t      g  |       ta |  t      g  |       gc |  a      t  |       cg g  g       gc        ta cg        gc        cg cg        gc        at gt        at        at                         ttttgtgttcttacaaatgaatgtaaaaaaggaggaaaaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1114 Branched-chain amino acid permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................