                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:198 nt.    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.30 kcal/mol
Antiterminator:    Distance from promoter:175 nt. Size=33 nt.     Delta G= -6.11 kcal/mol
Anti-antiterminator:    Distance from promoter:167 nt.    Size=29 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ataata-tatact. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccacg is shown in italic-bold style

ataataagcaataattaattaaatatactgtctgtgatgaagagagtagtcttttttagaaggaaagcgagctagggatggtgtgagcctagtgcggaag
aaaaagatgaagcgcacttcggagatgcttcttgaacgaatagtagagtgagccgaggccccctgtcctcgttataaacgggaaagtggttcgtaatgaa
caacaagggtggtaccacgggttcaaactcgtctcttttttagagacgagttttttgtgttttaaaaaataaggagggtgtagtATG

    BA_2670 Gene: BA_2670     GI: 21400045     BI number: BA_2670     GOG: COG0018     Description: tRNA-synt_1d, tRNA synthetases class I (R            ca           t  a            ta            gc            gt gg        gc t  t       cg g  a       at gc       c  |        t gc       c  |      t  t a  a      a  |      t  t a  c      t  |       ta c  g      g  |       cg a  g      g  |       ta a  |      t  |       cg cg        gc        ta at        gt        gc at        gc        cg gc        at        ta ta        at        cg                         ttttttgtgttttaaaaaataaggagggtgtagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0018 Arginyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................