                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:81 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-21.00 kcal/mol
Antiterminator: Size=20 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGTACATGATGCAAAGATCTACAGAGAGCAATCGGTTGCTGGAAAGATTGCGATACC
GCATGATGGAAAGACACCTGTGAgtgttgctttgaacgtgataattagtaaaagcaaacggtacctaccgttatcaggactaa
gatggtcattatgacaatttgggtggtaccgccgaaaaatccgtccctatttataggggcggatttttgtattctttgaaagggggtgagtgaccgtgga
tgatgacgatgacaacaacaataacgtaaataaatataaaattactggagggaaatgtaATG

    BA_2681 Gene: BA_2681     GI: 21400056     BI number: BA_2681     GOG: -------     Description: tRNA-synt_2, tRNA synthetases class II (D, K and N   g a  a a  t tg cg at gc |  a |  t |  t g  a at cg ta                  tt a  c                t  a ta                  at ta                  ta gt                  cg |  t                 cg |  t                 cg |  g       ta        tg cg       g  c       gc cg        gc        cg at        tg        cg t  |       gc        ta cg        gc        at cg       g  g       at at        ta        at ta        ta        at gc        ta        at                         gtattctttgaaagggggtgagtgaccgtggatgatgacgatgacaacaacaataacgtaaataaatataaaattactggagggaaatgtaATG                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-17.40 kcal/mol                                                                         Nomenclature/Definitions AAGTACATGATGCAAAGATCTACAGAGAGCAATCGGTTGCTGGAAAGATTGCGATACC GCATGATGGAAAGACACCTGTGAgtgttgctttgaacgtgataattagtaaaagcaaacggtacctaccgttatcaggactaa gatggtcattatgacaatttgggtggtaccgccgaaaaatccgtccctatttataggggcggatttttgtattctttgaaagggggtgagtgaccgtgga tgatgacgatgacaacaacaataacgtaaataaatataaaattactggagggaaatgtaATG     BA_2681 Gene: BA_2681     GI: 21400056     BI number: BA_2681     GOG: -------     Description: tRNA-synt_2, tRNA synthetases class II (D, K and N           tt          t  a           at           ta           cg           cg           cg           tg           gc           cg           cg           ta           at             ttttgtattctttgaaagggggtgagtgaccgtggatgatgacgatgacaacaacaataacgtaaataaatataaaattactggagggaaatgtaATG                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................