Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:157 nt.    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-10.90 kcal/mol
Antiterminator:    Distance from promoter:103 nt. Size=67 nt.     Delta G=-20.30 kcal/mol
Anti-antiterminator:    Distance from promoter:76 nt.    Size=43 nt.     Delta G=-13.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tatgat. It has a score value of 77.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacagtaacaagaagtatgttatgatgaatacgatacgaaaataaaatatttatccactaggggggcctattataggctgagatcaaattggaatttg
agactcttagtacctgatctggttaatgccagcgtagggaagtgggaaagacattgctatttcatgtataaatactgtcaatttcactttctttacgcct
gtaaagaaagtttttttattataaagcgttaattgctgtggataaatacttatatgaaatggattattggagggaatcaaATG

    BA_3124


Gene: BA_3124     GI: 21400499     BI number: BA_3124     GOG: COG0819     Description: TENA_THI-4, TENA/THI-4 famil


           tt
          t  c
          a  a
          t  t
           cg
           gt
           ta
          |  t
          |  a
          |  a
          |  a
          |  t
          |  a
          t  c
           at
 aa        cg
t  t       at
 tg        gc
 gc       a  a
 gc       a  a
 ta        at
 cg        gt
t  c       gt
a  g       gc
 gt        ta        cc
 ta        gc       g  t
 cg       |  t       cg
 cg        at        at
|  g       at        ta
a  a       gc        ta
t  a       gt        ta
g  g       gt        cg
 at        at        ta
 tg        ta        ta
 tg        gc        ta
 cg        cg        cg
 ta        gc        at
                        ttttttattataaagcgttaattgctgtggataaatacttatatgaaatggattattggagggaatcaaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG0819 Putative transcription activator ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Thiamine_Thi-box sequence ... can be seen here

    ..................................................................................................................