                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-22.40 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.23 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-18.24 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggcaccgcr is shown in italic-bold style

aataagatgaatttttcacagagagctccatttagctgaaaaggagtaaaaattctttattgaaccaagcctctgagcagcgcatcggaatctattaata
gagggtggtgtgacgggagctcccgttatagagctatggtataagcatgaatgaaaatgcagtaccagataaggttaatatggtgacatattaacaaact
agggtggcaccgcratgataaatctcgtccctaagactaaaagtcttgggggtgggatttttttattggtttaaaacaatttgaaaagcgggggcctaaa
ATG

    BA_3167 Gene: BA_3167     GI: 21400542     BI number: BA_3167     GOG: -------     Description: hypothetical protein predicted by GeneMar tg g  a gc ta at ta at at ta                   a ta         t       a  a gc       a  g      t  a g  a      r  a       cg a  a      c  t       at a  a      g  a       gc t  c      c  a       at a  t      c  a       at g  a      a  t       tg a  g      c  c       cg cg        gt        cg cg        gc        cg at        tg       t  g tg       |  t      g  t g  |       gc        cg a  |       gc        tg cg        gc        cg gc        at        ta ta        ta        at                         ttttttattggtttaaaacaatttgaaaagcgggggcctaaaATG                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................