                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -7.71 kcal/mol
Anti-antiterminator:   Size=10 nt.     Delta G= -1.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

AAATAAATTATCTTAAttccatattatatatgcgctgaagaggaaacagtagtgcttatctcactgttaaagagagctgatggtaggt
gtgaatcagtacaaagataagcatgaattacagccttggagcatcttttccgccaacttttggagggaaagacggtcaaatgatcgttaaagaagaagag
aggtagacaggtatttagtctacaactagggtggtaccgcgataaatatcgtccctactgagcgctcagtagggacttttttgtacaaaaaaatagtaaa
ggggcaagagaaATG

    BA_3465 --- BA_3464 --- BA_3463 --- BA_3462 Gene: BA_3465     GI: 21400840     BI number: BA_3465     GOG: COG0082     Description: Chorismate_synt, Chorismate synthase Gene: BA_3464     GI: 21400839     BI number: BA_3464     GOG: -------     Description: aminotran_1_2, Aminotransferase class I and II Gene: BA_3463     GI: 21400838     BI number: BA_3463     GOG: COG0287     Description: PDH, Prephenate dehydrogenase Gene: BA_3462     GI: 21400837     BI number: BA_3462     GOG: COG0128     Description: EPSP_syntase, EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase            aa           a  t            ta            at            gc            cg            gt        cg           c  |      g  c           c  |       at           a  |       gc           t  |       ta           g  |       cg           g  |       at           t  |       ta ta        gc        cg g  c       gc        cg gc        gc        cg tg        at        ta gc        ta        gc                         ttttttgtacaaaaaaatagtaaaggggcaagagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0082 Chorismate synthase ... can be seen here [E] COG0287 Prephenate dehydrogenase ... can be seen here [E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................