                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-17.00 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -7.81 kcal/mol
Anti-antiterminator:   Size=10 nt.     Delta G= -1.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

tatctttatgaagggaaagacggtcagatgatcgttaacaatgaagagaggtagacgaaagaagtctacaactagggtggtaccgcgataaatatcgtcc
ctactgattgcatcagtagggattttttgtacaaaaaaagtgggtttttaactagtagagagtgtctttgtacgaattattagtttaaaataagaagagg
tatcgattccactttaaatttgtataattgaccagttcagaaaatagagaatttttcattctcttactatacttttaaaacattagaggaggatttccaa
ATG

    BA_3466 Gene: BA_3466     GI: 21400841     BI number: BA_3466     GOG: COG2876     Description: DAHP_synth_1, DAHP synthetase I famil            aa           a  t            ta            at            gc            cg            gt           c  |           c  |           a  |           t  |           g  |           g  |           t  |            gc            gc         g            gc       t  c            at        ta            ta        at           c  c       gc           a  t       ta           a  |       cg           c  |       at           a  |       ta ta       t  |       cg g  c       cg        cg gc        ta        cg tg        gt        ta gc        at        gt                         tttttgtacaaaaaaagtgggtttttaactagtagagagtgtctttgtacgaattattagtttaaaataagaagaggtatcgattccactttaaatttgtataattgaccagttcagaaaatagagaatttttcattctcttactatacttttaaaacattagaggaggatttccaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2876 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................