Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:131 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.40 kcal/mol
Antiterminator:    Distance from promoter:110 nt. Size=34 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:    Distance from promoter:75 nt.    Size=42 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tatagt. It has a score value of 82.33 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaattaaaatgaaattatgtatagtaagaattaagtgaatattttcttatccagagaggtggagggactggcccgatgaaacccagcaaccgcgat
gcaggtgctaattccagcagaacaaatttgttctgggagataagacgaagatatatacgtaacttcttcttatcggagaggtttttttattgcaaaaaaa
ccgattacgaaaaaatttatattaagaagaaaggggttgcgaagtactGTG

    BA_3859


Gene: BA_3859     GI: 21401234     BI number: BA_3859     GOG: -------     Description: hypothetical protein predicted by GeneMar


 at
a  t
 at
 cg
 at
 at        ta
 gc       a  c
 at        tg
 cg        at
g  |       ta
a  |      a  a        a
 cg        gc       t  t
 cg        at       t  c
 ta        at        cg
 tg        gc        tg
a  a      c  t       ta
 at        at        cg
 ta        gc        ta
c  a       at        tg
g  g       at        cg
 ta        ta        at
 gc        at        at
                        tttttattgcaaaaaaaccgattacgaaaaaatttatattaagaagaaaggggttgcgaagtactGTG


                                                                        Genes that have a predicted attenuator with a riboswitch:

Methionine_S-box sequence ... can be seen here

    ..................................................................................................................