                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-29.70 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -8.41 kcal/mol
Anti-antiterminator:   Size=8 nt.     Delta G= -1.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

attaagaaaaacgaagatagggataagtacctttttcataccttatatagcgaactgaggatggtgtaagctcaggataaggagataatgggaatatcac
cctggagttccgcgctgaacaaatagagtaagcgtaggcgtatattcgcgttaagaatataaagagggttgtatacatacgtataggatctactagggtggtaccgcgggagactttctcgtccctttttgggatgagaaagtctcttttttatrccgmtttttaggmctttcttttatacatgtaaggaggaattgagc
ATG

    BA_4505 Gene: BA_4505     GI: 21401880     BI number: BA_4505     GOG: COG0060     Description: tRNA-synt_1, tRNA synthetases class I (I, L, M and V             c         t           a  t      t  t            gt       t  t            at        cg            gc        cg            gt        cg            gc        ta            cg        gt            gt        cg           c  |       ta           c  |       cg           a  |       ta           t  |       ta           g  |       ta           g  |       cg           t  |       at ag        gc        gc g  a       gc        at gc        gc        gc gt        at        gt                         tttttatrccgmtttttaggmctttcttttatacatgtaaggaggaattgagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0060 Isoleucyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................