Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:154 nt.    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.50 kcal/mol
Antiterminator:    Distance from promoter:137 nt. Size=32 nt.     Delta G=-12.00 kcal/mol
Anti-antiterminator:    Distance from promoter:100 nt.    Size=50 nt.     Delta G=-13.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-caaaat. It has a score value of 89.02 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaacatgaaaaatatctgacaaaattcagttatcttaaaaatttaaacatttctaaatacttcttatcaagagcaggtggagggacgagcccgacg
aaacccggcaaccgatctacataattgtagacacggtgctaattctcgcagcattacgctgacagataaggagctggttgtaaaaaaacctctccttagc
tgagaggtttttttatttaactaggaggttataacaATG

    BA_4714 --- BA_4715 --- BA_4716 --- BA_4717


Gene: BA_4714     GI: 21402089     BI number: BA_4714     GOG: COG1850     Description: RuBisCO_large, Ribulose bisphosphate carboxylase large chain, catalytic domain
Gene: BA_4715     GI: 21402090     BI number: BA_4715     GOG: COG4359     Description: Hydrolase, haloacid dehalogenase-like hydrolase
Gene: BA_4716     GI: 21402091     BI number: BA_4716     GOG: COG0235     Description: Aldolase_II, Class II Aldolase and Adducin N-terminal domain
Gene: BA_4717     GI: 21402092     BI number: BA_4717     GOG: COG1791     Description: ARD, ARD/ARD' famil


  t
t  a
a  c
 cg
 gc
 at
 cg
g  a
c  c
 ta         a
 cg       a  a
 ta       t  a        a
t  t      g  a      t  g
a  a       ta       t  c
a  a       ta       c  t
 tg        gc        cg
 cg        gc        ta
g  a      t  t       cg
 tg       c  |       ta
 gc        gc        cg
 gt        at        cg
 cg        gc        at
a  |       gc        at
 cg        at        at
 at        at        at
 gt        ta        at
                        ttatttaactaggaggttataacaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG1850 Ribulose 1,5-bisphosphate carboxylase, large subunit ... can be seen here
[E] COG4359 Uncharacterized conserved protein, possibly involved in methylthioadenosine recycling ... can be seen here
[G] COG0235 Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases ... can be seen here
[S] COG1791 Uncharacterized conserved protein, contains double-stranded beta-helix domain ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Methionine_S-box sequence ... can be seen here

    ..................................................................................................................