                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:167 nt.    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-20.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tagatt-tatgtt. It has a score value of 65.6 and is shown in blue

tagattcaattcaaatctatatatatgttttattttgtatacttatctttctatgctgaaataaaaagatacgactagcgtttgaaaaatttgatatttt
tgctaggtttcttccttatgccaaaatatcaatcatcgttaggtttctttcctatactttcgtattcgaactatatttctagaaatcacgtctcccaaac
cccaaggatattaaaatccttggggttttttgttttttttaggagaggtgaagaaaATG

    BA_4789 --- BA_4790 --- BA_4791 --- BA_4792 Gene: BA_4789     GI: 21402164     BI number: BA_4789     GOG: COG1985,COG0117     Description: RibD_C, RibD C-terminal domain Gene: BA_4790     GI: 21402165     BI number: BA_4790     GOG: COG0307     Description: Lum_binding, Lumazine binding domain Gene: BA_4791     GI: 21402166     BI number: BA_4791     GOG: COG0108,COG0807     Description: DHBP_synthase, 3,4-dihydroxy-2-butanone 4-phosphate synthase Gene: BA_4792     GI: 21402167     BI number: BA_4792     GOG: COG0054     Description: DMRL_synthase, 6,7-dimethyl-8-ribityllumazine synthas           ta          t  a          a  a           ta           at           gc           gc           at           at           cg           cg           cg           cg           at           at           at             tttgttttttttaggagaggtgaagaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012 This operon is putativelly rgulated by Riboflavin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:167 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-20.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tagatt-tatgtt. It has a score value of 65.6 and is shown in blue tagattcaattcaaatctatatatatgttttattttgtatacttatctttctatgctgaaataaaaagatacgactagcgtttgaaaaatttgatatttt tgctaggtttcttccttatgccaaaatatcaatcatcgttaggtttctttcctatactttcgtattcgaactatatttctagaaatcacgtctcccaaac cccaaggatattaaaatccttggggttttttgttttttttaggagaggtgaagaaaATG     BA_4789 --- BA_4790 --- BA_4791 --- BA_4792 Gene: BA_4789     GI: 21402164     BI number: BA_4789     GOG: COG1985,COG0117     Description: RibD_C, RibD C-terminal domain Gene: BA_4790     GI: 21402165     BI number: BA_4790     GOG: COG0307     Description: Lum_binding, Lumazine binding domain Gene: BA_4791     GI: 21402166     BI number: BA_4791     GOG: COG0108,COG0807     Description: DHBP_synthase, 3,4-dihydroxy-2-butanone 4-phosphate synthase Gene: BA_4792     GI: 21402167     BI number: BA_4792     GOG: COG0054     Description: DMRL_synthase, 6,7-dimethyl-8-ribityllumazine synthas           ta          t  a          a  a           ta           at           gc           gc           at           at           cg           cg           cg           cg           at           at           at             tttgttttttttaggagaggtgaagaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................