                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:44 nt.    Distance to gene:143 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-20.40 kcal/mol
Antiterminator:    Distance from promoter:20 nt. Size=33 nt.     Delta G= -8.11 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaacg-tatttt. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

ttaacgcatatcatacgaccctttattttgtgatacattcatttcacaagctagggtggtaccgcgatttcttcgtccctgcataattatatgcagggac
gtttttttatccaatcatttccgcatcatattgagatatggacaattaccggtaatttgtcacaaaattctaaaatttagaaggaaataaacaatattgg
cgaattttatataaaaaagagctattttagattacttaggaggggaaaacaATG

    BA_4802 Gene: BA_4802     GI: 21402177     BI number: BA_4802     GOG: COG1757     Description: hypothetical protein predicted by GeneMar tt a  c c  a a  t t  t        t at       t  c gc       t  t ta        at gc        gc ta        cg ta        gt tg       c  |       tt t  c      c  |      a  a a  t      a  |       at t  |      t  |       ta t  |      g  |       at ta       g  |       cg cg       t  |       gc cg        gc        ta cg        gc        cg at        gc        cg g  g       at        cg cg       t  |       ta at        cg        gc ta        gc        cg                         tttttttatccaatcatttccgcatcatattgagatatggacaattaccggtaatttgtcacaaaattctaaaatttagaaggaaataaacaatattggcgaattttatataaaaaagagctattttagattacttaggaggggaaaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1757 Na+/H+ antiporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................