Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:140 nt.    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.10 kcal/mol
Antiterminator:    Distance from promoter:117 nt. Size=38 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:    Distance from promoter:79 nt.    Size=50 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttg-taaaat. It has a score value of 80.32 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgttgtaaagttaaaaccataataaaatttcatacgaacattcttatctagagaggtagagggactggccctatgacgcctcagcaaccattaacattt
gttaataaggtgctaattccagcaaattgcgaaaaatttgacagatgagaagaagactctattcaaaccgaaagccttcttcttagaaggctttttttat
tttatattcaactactggttcaatttaaaaaggaggaatttttacATG

    BA_4927 --- BA_4928


Gene: BA_4927     GI: 21402302     BI number: BA_4927     GOG: COG0626     Description: Cys_Met_Meta_PP, Cys/Met metabolism PLP-dependent enzyme
Gene: BA_4928     GI: 21402303     BI number: BA_4928     GOG: COG0626     Description: Cys_Met_Meta_PP, Cys/Met metabolism PLP-dependent enzym


 ga
c  a
g  a
 ta
 ta
 at
 at
 at         a
 cg       a  c
|  a      a  c
|  c       cg
|  a       ta
|  g       ta
g  a      a  |
 at       t  |
 cg       c  |       ct
|  a       ta       t  t
 cg        cg        ta
 ta       a  c       cg
 ta        gc        ta
a  g       at        ta
a  a       at        cg
 ta        gc        cg
 cg        at        gc
g  |       at        at
 ta        gc        at
 gc        at        at
 gt        gt        gt
                        tttattttatattcaactactggttcaatttaaaaaggaggaatttttacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0626 Cystathionine beta-lyases/cystathionine gamma-synthases ... can be seen here
[E] COG0626 Cystathionine beta-lyases/cystathionine gamma-synthases ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Methionine_S-box sequence ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:143 nt.    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.00 kcal/mol
Antiterminator:    Distance from promoter:105 nt. Size=38 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:    Distance from promoter:67 nt.    Size=50 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttg-taaaat. It has a score value of 80.32 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgttgtaaagttaaaaccataataaaatttcatacgaacattcttatctagagaggtagagggactggccctatgacgcctcagcaaccattaacattt
gttaataaggtgctaattccagcaaattgcgaaaaatttgacagatgagaagaagactctattcaaaccgaaagccttcttcttagaaggctttttttat
tttatattcaactactggttcaatttaaaaaggaggaatttttacATG

    BA_4927 --- BA_4928


Gene: BA_4927     GI: 21402302     BI number: BA_4927     GOG: COG0626     Description: Cys_Met_Meta_PP, Cys/Met metabolism PLP-dependent enzyme
Gene: BA_4928     GI: 21402303     BI number: BA_4928     GOG: COG0626     Description: Cys_Met_Meta_PP, Cys/Met metabolism PLP-dependent enzym


 tt
a  c
a  c
 ta
 cg
 gc
 ta
g  a
g  a        g
 at       a  a
 at       a  c
 tg        gt
|  c       ac
|  g       at
|  a      g  |
|  a      a  |
|  a      g  |
|  a       ta
|  a       at
|  t      g  t       ct
 at        ac       t  t
 at        ca        ta
 tg        aa        cg
 ta        ga        ta
 gc        tc        ta
 ta        tc        cg
 tg        tg        cg
 ta        aa        gc
 at        aa        at
                        ttttttattttatattcaactactggttcaatttaaaaaggaggaatttttacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0626 Cystathionine beta-lyases/cystathionine gamma-synthases ... can be seen here
[E] COG0626 Cystathionine beta-lyases/cystathionine gamma-synthases ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Methionine_S-box sequence ... can be seen here

    ..................................................................................................................