                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:140 nt.    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.10 kcal/mol
Antiterminator:    Distance from promoter:117 nt. Size=38 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:    Distance from promoter:79 nt.    Size=50 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttg-taaaat. It has a score value of 80.32 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgttgtaaagttaaaaccataataaaatttcatacgaacattcttatctagagaggtagagggactggccctatgacgcctcagcaaccattaacattt
gttaataaggtgctaattccagcaaattgcgaaaaatttgacagatgagaagaagactctattcaaaccgaaagccttcttcttagaaggctttttttat
tttatattcaactactggttcaatttaaaaaggaggaatttttacATG

    BA_4927 --- BA_4928 Gene: BA_4927     GI: 21402302     BI number: BA_4927     GOG: COG0626     Description: Cys_Met_Meta_PP, Cys/Met metabolism PLP-dependent enzyme Gene: BA_4928     GI: 21402303     BI number: BA_4928     GOG: COG0626     Description: Cys_Met_Meta_PP, Cys/Met metabolism PLP-dependent enzym ga c  a g  a ta ta at at at         a cg       a  c |  a      a  c |  c       cg |  a       ta |  g       ta g  a      a  | at       t  | cg       c  |       ct |  a       ta       t  t cg        cg        ta ta       a  c       cg ta        gc        ta a  g       at        ta a  a       at        cg ta        gc        cg cg        at        gc g  |       at        at ta        gc        at gc        at        at gt        gt        gt                         tttattttatattcaactactggttcaatttaaaaaggaggaatttttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0626 Cystathionine beta-lyases/cystathionine gamma-synthases ... can be seen here [E] COG0626 Cystathionine beta-lyases/cystathionine gamma-synthases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012 This operon is putativelly rgulated by Methionine_S-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:143 nt.    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.00 kcal/mol Antiterminator:    Distance from promoter:105 nt. Size=38 nt.     Delta G=-10.40 kcal/mol Anti-antiterminator:    Distance from promoter:67 nt.    Size=50 nt.     Delta G= -8.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgttg-taaaat. It has a score value of 80.32 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgttgtaaagttaaaaccataataaaatttcatacgaacattcttatctagagaggtagagggactggccctatgacgcctcagcaaccattaacattt gttaataaggtgctaattccagcaaattgcgaaaaatttgacagatgagaagaagactctattcaaaccgaaagccttcttcttagaaggctttttttat tttatattcaactactggttcaatttaaaaaggaggaatttttacATG     BA_4927 --- BA_4928 Gene: BA_4927     GI: 21402302     BI number: BA_4927     GOG: COG0626     Description: Cys_Met_Meta_PP, Cys/Met metabolism PLP-dependent enzyme Gene: BA_4928     GI: 21402303     BI number: BA_4928     GOG: COG0626     Description: Cys_Met_Meta_PP, Cys/Met metabolism PLP-dependent enzym tt a  c a  c ta cg gc ta g  a g  a        g at       a  a at       a  c tg        gt |  c       ac |  g       at |  a      g  | |  a      a  | |  a      g  | |  a       ta |  a       at |  t      g  t       ct at        ac       t  t at        ca        ta tg        aa        cg ta        ga        ta gc        tc        ta ta        tc        cg tg        tg        cg ta        aa        gc at        aa        at                         ttttttattttatattcaactactggttcaatttaaaaaggaggaatttttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0626 Cystathionine beta-lyases/cystathionine gamma-synthases ... can be seen here [E] COG0626 Cystathionine beta-lyases/cystathionine gamma-synthases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................